Ntbbf1arrolb

Author: jkpt

August undefined, 2024

Web1 jun. 2010 · A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S , controlling the expression of a gene with unknown function from cassava ( Manihot esculenta ) and of the storage protein … Web6 feb. 2024 · Sucrose is an important component of fruit flavor, but whether sucrose signaling affects the postharvest ripening process of kiwifruit is unclear. The aim of this …

Expression of - SpringerLink

Web1 jun. 2009 · We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL ( WUS ) and SHOOTMERISTEMLESS ( STM ). When ~3 kb of the 5′ flanking regions of close homologs were used to drive expression of the GUSPlus gene, … Web1 feb. 2016 · Diversity analysis of maize GH3 genes The GH3 gene family is widely distributed in plant king- dom. GH3 genes have been identified and characterized in … botins melissa

Frontiers Pepper Fruit Elongation Is Controlled by …

Web4 mei 2015 · Notably, seven auxin-responsive cis-elements (NTBBF1ARROLB and AUXREPSIAA4)/auxin response factor-binding sites (ARFAT) and 11 nodulin consensus … Web2 mrt. 2024 · One to six (depending on the gene) salicylate-responsive elements (TCA-element, WBOXATNPR1), auxin-responsive elements (TGA-element, NTBBF1ARROLB, gibberellin-responsive elements (MYB, P-box, GARE1OSREP1) and transcriptional repressor of the gibberellin pathway (WRKY71OS) (Figure 2) were also detected. WebThis review examines how phytoglobins (Pgbs), proteins associated with stress responses and able to modulate nitric oxide (NO) homeostasis, also control fundamental aspects of … botkeskoalle

Ntbbf1arrolb

Identification and characterization of the - ScienceDirect

Web12 mrt. 2012 · NTBBF1ARROLB: 10: Required for tissue-specific expression and auxin induction; Agrobacterium rhizogenes: SEBFCONSSTPR10A: 3: Similar to the auxin … Web2 okt. 2012 · ntbbf1arrolb site 177 (+) acttta s000273 OSE1ROOTNODULE site 659 (+) AAAGAT S000467 OSE2ROOTNODULE site 249 (+) CTCTT S000468

Did you know?

Web16 feb. 2024 · Among the enriched CAREs, four (NTBBF1ARROLB, SORLIP5AT, ANAC_C3b and E2FCONSENSUS) were unique to a given subnetwork, and two (RVE1–2 and LECPLEACS2) were only co-enriched in the VviATL89 (VIT ... Web1 mei 2014 · Among these elements, NTBBF1ARROLB motif (ACTTTA) is the binding site for NtBBF1 (Dof protein) and is required for auxin induction, gene expressions in …

Web30 jan. 2024 · As a control, free GFP (pTF486) was transiently expressed in tomato protoplasts. Fluorescence was examined with a confocal laser scanning microscope … WebShaded rows indicate that putative cis-regulatory elements were detected in all 3 promoters. cis Element Sequence Number of Elements GmActin GmRpS11 GmHsp90 1 2 0 Predicted Function -10 promoter element, light -10PEHVPSBD TATTCT regulation and circadian rhythms, chloroplast gene 2SSEEDPROTBANAPA CAAACAC 0 1 0 …

Web16 apr. 2015 · Furthermore, the SlARF9 promoter sequence contains several NTBBF1ARROLB-elements. These elements were first identified in the promoter sequence of rolB , one of the oncogenes present in the T-DNA sequence of Agrobacterium rhizogenes , and are involved in the auxin-inducible expression of the rolB -gene in plants ( … WebAnalysis of signal sequence motifs in the promoter regions of the Arabidopsis class 1 and class 2 Pgbs

Web22 nov. 2012 · Abstract. Table S1. Identification of hormone-responsive cis-acting elements within the 5’-region of barley genes potentiated by Pseudomonas fluorescens (strain …

Web9 nov. 2024 · Main conclusion Several cis-elements including Myb-binding motifs together confer glandular trichome specificity as revealed from heterologous expression and … botki heliosWeb9 okt. 2014 · -2801 ggctggtttctaagacattttttggtttaatccaaacctaattacaa atatt cccaacaa rootmotiftapox1 -2741 gatcgaatgatctatggctacaaaccctatcccaacaaaaaactacatttagtacatcaa -2681 ... botki hispanitas hi222345 rio-122almondWeb15 jan. 2024 · Some cis-elements involved in the regulation of light-controlled genes such as INRNTPSADB, NTBBF1ARROLB and TBOXATGAPB were also part of the deleted … botiss jasonWebGenerate, customise, save, share, gift, print, browse & love word cloud art with WordItOut, the free word cloud maker online since 2010. botki jesien 2022Web21 sep. 2024 · Background Transgenic technology has become an important technique for crop genetic improvement. The application of well-characterized promoters is essential for developing a vector system for efficient genetic transformation. Therefore, isolation and functional validation of more alternative constitutive promoters to the CaMV35S … botki ottimoWebIn the promoter of the WUS gene of Arabidopsis and its two orthologs in Populus trichocarpa (PopWUS1 and PopWUS2) various auxin sensitive elements were detected: AuxRE, … botkesa viantaWeb10 nov. 2024 · We chose to focus on three auxin response elements: the AuxRR-core (GGTCCAT), TGA-element (AACGAC), and ntBBF1ARROLB (named BBF) (ACTTTA), … botki nessi 20748